Science topic

Real-Time PCR - Science topic

Explore the latest questions and answers in Real-Time PCR, and find Real-Time PCR experts.
Questions related to Real-Time PCR
  • asked a question related to Real-Time PCR
Question
10 answers
Hi, I'm doing presence/absence experiments with a comercial kit qPCR. The software requires an IPC-blocking agent but the kit does not have. Is there any configuration that allows it without IPC blocking agent? Moreover, the presence/absence graph does not appear in the analysis.Who know how to fix this problem? Thanks.
Relevant answer
Answer
Hi Cristina how do you fix the problem iam having the same one using a diagnostic test for presence and absence using step one plus. Can you help me out?
  • asked a question related to Real-Time PCR
Question
4 answers
I extracted RNA from flax seedlings to measure microRNA expression by stem-loop PCR. I have done this many times with the CTAB method and often the 260/280 ratio is good and around 2 but the 260/230 ratio is between 2.3 and 2.4. Is there a problem with this ratio for cDNA synthesis or real-time PCR? Does this ratio have to be between 1.8-2.2? Please guide me if you have experience in this field.
Relevant answer
Answer
I agree with the Biswajit and Sandeep. I would just add that I have had very successful qPCRs with ratio as low as 1.5. It is not ideal, but as long as it is not a VERY low abundance RNA that is being targeted, you should be able to get it to work and it will still be clean data. Values above 2.2 are concerning. If you have a drying step in your purification, I would advise extending that a bit to help any leftover organics evaporate. Hope that helps!
  • asked a question related to Real-Time PCR
Question
3 answers
Hello, researchers! Do you have any protein extraction protocols or tips that I could use for extracting SARS-CoV-2 spike and nucleocapsid proteins? I already know that a lot of protocols are virus dependent and that people use salts.
Considering clinical samples are in swabs and in transport medium for COVID19 real-time PCR diagnostic too, should we do a pre-treatment or something, before starting the extraction? What do you suggest?
I appreciate the help right away :)
Relevant answer
Answer
The idea is novel . The spike protein extraction option should be applied to delta variants .
  • asked a question related to Real-Time PCR
Question
4 answers
Dear friends!
1. Is there any DETAILED algorithms/videos to design primers and probes for real-time PCR?
2. Do probes really give much accurate results and are easier to work with (troubleshooting)?
Will be grateful to any speculations on that point.
Have a great day 😊
Relevant answer
Answer
Hi Anna,
1. The tools mentioned by Bhairavi are commonly used, especially IDT and primerblast. However, if you are lucky enough to be working with mouse, human or rat, IDT sells pre-designed primer probe sets for most targets. https://www.idtdna.com/site/order/qpcr/predesignedassay
These have already been through trouble-shooting and offer very good results from the first run.
2. Yes, Primer-probes are very nice to work with and tend to give a higher degree of precision than SYBR green. (Can do a serial dilution and determine copy-number if you want to.) Troubleshooting is usually minimal. This is especially true with the pre-designed assays.
Good luck!
BWE
  • asked a question related to Real-Time PCR
Question
2 answers
I have carried out Real-Time PCR in Applied Biosystem 7500. I mistakenly used relative quantification option instead of absolute quantification option. So I cant get Ct Value. But I have typical curve. There is any possibility to calculate the Ct value using the same hyperbolic curve in same software. I have limit of reagents only. Plz help me.
Relevant answer
Answer
I must agree with John Hardy Lockhart .
Do check if you enabled the Ct-value to be shown in your wells (software).
See figure below.
Good luck with your experiments and feel free to contact me if you have any other problems with the ABI software.
  • asked a question related to Real-Time PCR
Question
6 answers
I want to do an absolute real-time PCR for quantifying the expression of 2 different genes. is it necessary to consider a reference gene? what is its role?
Relevant answer
Answer
The reference gene serves as a loading control. Normalizing to a reference gene expression improves the accuracy and precision in cases where you may have some variance in sample preparation, RNA isolation, or cDNA synthesis. I recommend to always measure one (or better even a couple of) reference gene(s), unless you are absolutely sure that you don't have and variance in sample preparation/RNA isolation/cDNA sysnthesis, and if you don't even want to cross-check that everything really works as wanted/expected.
  • asked a question related to Real-Time PCR
Question
3 answers
All components are freeze-dried. We use AB7500.
compare the liquid state,  the other channels' noise signal of freeze-dried components are very high when we only detect one channel
Relevant answer
Answer
Hi Jing,
Have you solved the problem? I have a similar problem in one of the multiplex PCR involving FAM, Hex and Rox channels. Among them Hex is creating troubles with either false positive and/OR giving non-sigmoidal curve shapes similar to what you have shown in your question. Please help. Thanks
  • asked a question related to Real-Time PCR
Question
3 answers
Hello everybody,
In my q-PCR results, I got negative delta Ct values for some genes (where the GOI expression is higher than the reference gene).
In this case, should I repeat the q-PCR runs for the GOI with diluted samples to obtain positive delta Ct? or is there any analysis method that is appropriate with such cases?
Thank you
Relevant answer
Answer
Uh...no. This is fine.
Subtracting ref gene Cq values is a log-space operation, equivalent to division in linear terms, exactly as you should do with a reference.
All you're actually interested in is the relative differences between your samples, for your GOI, and those differences are, as noted, relative: it doesn't really matter what the actual expression level is.
If, after normalisation, two samples are different by four cycles, that's a 16-fold difference. It doesn't matter if one sample is "2" and the other "6", or if one is -"2" and the other "2", or one is "-4" and the other "0", or whatever: it's the difference between them which matters.
If I'm honest, I find that dCt/ddCt methods usually cause more confusion than anything else, because many people are uncomfortable with log-space operations and data (and also, dCt methods assume identical efficiency, which is not necessarily the case).
I typically recommend transforming everything into linear values (relative quantities, RQ) and then just dealing with those instead.
For this, you take all the Cq values for a given gene, and find the lowest value (highest expression).
Then for each sample, the equation is
Sample RQ = efficiency(lowest Cq - sample Cq)
Where efficiency is extent of doubling at each cycle (so 100% efficient = 2.0, 95% efficient = 1.95 etc).
What this does is render all of your sample values linear, relative to the highest expression, on a scale of 0-1.
You then do the same for your reference genes, determine the geometric mean of those to generate a normalisation factor, and then divide all your GOI RQ values by the normalisation factor (because we're in linear terms now, so normalisation is a division operation).
And now you have normalised, linear data.
If one sample is 0.1 and another is 1.6, that's a 16-fold difference.
This way you don't have to worry about negative data and what it means.
  • asked a question related to Real-Time PCR
Question
5 answers
I have some qPCR data that I want to analyze with LinRegPCR, but I can't find the way to export the data in a format recognized by LinReg.
Relevant answer
Answer
Hi Irfan and Laura. i can't do it. The software show me a message "Could not open text file for exporting data". How can i do to solve it?
  • asked a question related to Real-Time PCR
Question
14 answers
Is it possible to run a real-time PCR product in agarose gel electrophoresis? Would bands be visualised?
Relevant answer
Answer
Yes, you can and should run out the products on a gel while optimizing the protocol or if you are getting unexpected results. The bands will be a bit "fuzzy" if you did a melt curve first, but a melt curve is generally the least informative part of a qPCR experiment. A gel is the quickest way to check for contamination and/or amplification in your noRT controls
  • asked a question related to Real-Time PCR
Question
3 answers
Please comment from your experience of handling all 3 machines.
Relevant answer
Answer
Could anybody please share me how much is a Biorad CFX96 touch ?
  • asked a question related to Real-Time PCR
Question
4 answers
Hi everyone,
I want to do the gene expression test using real-time PCR, but I'm struggling with choosing the optimal housekeeping gene for my experiment? Do you have any advice for me? Thanks for your help.
Relevant answer
Answer
You realise that without telling us what your organism of interest is, this question is essentially impossible to answer? People could suggest beta tubulin or whatever, but if you're studying bacteria then that won't be much help.
Anyway, my advice would be to determine it empirically, as Vanita Malekar suggests. Pick a fairly representative set of samples, including both test and control samples (say 10 of each), and take a panel of candidate reference genes (8-10 is a good number), then obtain Cq values for all your samples for all your candidates.
Then run these through geNorm, normfinder and bestkeeper (also dCt if you like), and pick the two or three that consistently score highest.
Note: you should do this for every unique comparative scenario you're interested in, so it may be worth doing it extensively, once, rather than repeating it for new scenarios each time. And if you find some genes that appear to be suitable under essentially all conditions, that's neat. Also, you can publish this stuff.
(shameless self-citation follows)
  • asked a question related to Real-Time PCR
Question
2 answers
I carried out 10 technical replicates for determining LOD95%. Below is the result (concentration in copy/mL, how many replicate amplified, and its positive rate)
10107 (10/10, 100%)
7580 (7/10, 70%)
5054 (6/10, 60%)
2527 (3/10, 30%)
1011 (1/10, 10%)
The result for LOD95 using Probit analysis is higher than 10107 copy/mL.. it is weird since the last concentration that shows 100% amplification is 10107.. can anyone help why this happens?
Relevant answer
Answer
I think figure that I added to the answer should help you
  • asked a question related to Real-Time PCR
Question
7 answers
I would like to compare expression of my gene of interest (GOI) in non-treated leaves, stems, roots of my plant. In that case I don't have any control sample here and it's not possible to have one for such analysis. Efficiencies of GOI and reference gene primers differs above 5% and the efficiencies are not near to 100%. In that case I can't use delta delta ct method. I could use Pfaffl formula, but I don't have control sample (calibrator). How can I analyze my qPCR data?
Relevant answer
Answer
Please read this link contain same your question:
Best regards
  • asked a question related to Real-Time PCR
Question
2 answers
Does the Illumina Eco Real-time PCR system require calibration for HRM (SNP detection)? The system manual mentions 'no temperature shift or calibration required'. However, I need to be certain before designing my experiments.
Any help would be appreciated.
Relevant answer
Answer
Could you help me out with a few more details if its possible? The kit manual for Illumina Eco mentions the following:
For Relative Quantification and HRM experiments: Select at least one Reference sample'.
However, since I do not know the exact genotype (WT, HT, Mut) initially, how do I assign a reference sample for the same? Or do you advise that I sequence my reference samples first for confirmation of the genotype prior to HRM analysis?
  • asked a question related to Real-Time PCR
Question
3 answers
I am detecting HAV mRNA by real time PCR using an in house developed technique (one-step RT-qPCR using TaqMan chemistry). The PCR program consists of 45 cycles.
Because the purpose of the method is qualitative, we will calculate the cut off value by statistical methods assigning only positive/negative results to our measurements (we use international standards). To do that, I first need to decide up to which Cq I will judge a sample as positive. Is there one correct way to set the threshold line in EVERY run so that we can have a Cq value that discriminates positive from negative samples?
My question relates to the fact that sometimes, we observe late amplification in samples that are thought to be negative and we want to know how to draw the line to separate them from ttuly positive ones.
Relevant answer
Answer
My guess is that virally infected samples will typically be hooching with virus, while virus negative samples will be "noise".
In other words, your assay will implicitly determine these thresholds for you, because it should be a yes/no scenario.
If it isn't a yes/no scenario, the better question is...why not?
For reference, we run viral shedding assays for gene therapy treatments, where viral titre should absolutely exist on a spectrum, and here it drops from "oh wow, we could practically detect this by eye" down to "maybe there's a viral genome, maybe not".
On such a spectrum, there is clearly no fixed point at which you can say there is ZERO virus, but you can increasingly claim that viral titre is at the lowest limit of detection. in a scenario of "infected or not", this distinction should be incredibly clear.
As a ballpark, a Cq of 35 cycles is considered to be equivalent to ~1 target molecule, so you can adjust you expectations based on this. My guestimate, based on having seen none of your data, is that anything above 28* or so, consider positive. Anything below 28*, test again. Anything below 35: ignore.
*hugely context specific, because I am not an HAV specialist: if known positive samples usually give Cqs of 15, then 28 is almost 10,000 times lower, so probably represents a negative -adjust based on general values for +ve/-ve ctrls
  • asked a question related to Real-Time PCR
Question
1 answer
Can anyone tell me if NALC-NaOH is suitable for liquefaction of sputum for real-time pcr amplification of non TB pathogenic bacteria and virus.
Otherwise how to prepare NALC-NaOH or NALC PBS buffer 2%
Relevant answer
Answer
Hi, did someone replied your question?
  • asked a question related to Real-Time PCR
Question
4 answers
I am using TaqMan probes for SNP genotyping on LightCycler 480. I am facing some difficulties in resolution of heterozygous genotypes. The software can not identify it as " both alleles" automatically. I am using Universal TaqMan master mix with UNG.
Can anyone suggest me if including UNG activation in cycling conditions will make any difference in fluorescence call of FAM or VIC dye?
Other suggestions?
Relevant answer
Answer
I am planning to genotype few SNPs using Taqman SNP genotyping. So this discussion would be very much useful for me.
  • asked a question related to Real-Time PCR
Question
3 answers
Hi, I want to isolate protein and RNA from the same frozen cells in SOLD buffer( RLT buffer+ beta mercaptoethanol). I will use RNA in the Real-time PCR and use protein in Western-blot. Anyone can help me?
  • asked a question related to Real-Time PCR
Question
6 answers
I want to do HRM analysis from melt curve data which was generated from real time qPCR instrument of Bio-Rad CFX96. Our lab did not provide the original software from Bio-Rad (Precision Melt Analysis Software). Now, I kinda stuck. Any suggestion for free software that could process Bio-Rad melt curve data for HRM analysis?
Thanks!
  • asked a question related to Real-Time PCR
Question
5 answers
To dear Researchers,
I was analyzing a series of concentration for estimation of Real-Time PCR efficiency. The concentration was 1:10. I used MS-excel to evaluate Slope. The result of slope was -8 and it was consistence with that in Scatter plot equation. I also drew a line plot. In the line plot the slope was -3.2 and the efficiency was 100%. Also, there was no linearity in Scatter plot but there was a well fitted linearity (0.99) in line plot. I'm not sure what is the problem. Please help me figure it out.
Kind regards
Alireza
Relevant answer
Answer
Ok, had a look.
The problem is the student is plotting Cq (a log2 metric) against concentration (a linear metric), which gives you a ridiculous skew that is impossible to fit a line to. You can fit a log-curve to it (really well, for obvious reasons), but this is not how you do generally do it.
You either linearise your Cq values, or log transform your concentrations (the latter is much easier, and arguably more informative, here).
This (a log/log plot) generates linear data, with (as expected) the gradient of -3.28.
I've attached my edited version.
  • asked a question related to Real-Time PCR
Question
6 answers
Hi,
I want to multiplex some reaction with dual label probes.
I check the probes on FAM, and HEX channel. When I change the dye for ROX channel I don't see any fluorescent. I ordered the probes from two different companies, and both doesn't work.
I want to mix 3 probes in my reaction for FAM, HEX and ROX channel
Relevant answer
Answer
Any idea whether ROX is compatible with taqman MGB probes for multiplexing through Stepone or LC96?
  • asked a question related to Real-Time PCR
Question
3 answers
Other people in my lab have used NormFinder but I'm trying to find other options which are user friendly as well
Relevant answer
  • asked a question related to Real-Time PCR
Question
5 answers
I Know that RT-PCR is Reverse Transcription PCR when the starting material is RNA. Going for reverse transcription first (RNA to cDNA) and then it could be conventional PCR with the need for gel electrophoresis or it could be real-time PCR reading the results without electrophoresis.
qPCR measures the amplification or we can say quantification, so qPCR and real-time PCR are the same? qPCR can be RT-qPCR if RNA is starting genetic material in reaction? Please if someone could clarify all these things in simple manner, it would be helpful.
Relevant answer
Answer
Hello Meghraj
Let me explain to you. As rightly mentioned by you RT-PCR uses RNA as the starting material which is converted to cDNA by reverse transcriptase and once the cDNA is formed the standard PCR procedure is performed to amplify the cDNA.
In RT-qPCR the first step mentioned above remains unchanged i.e. RNA is converted to cDNA by reverse transcriptase. However, the second step changes. qPCR is performed on the cDNA so formed which means the DNA is quantified in real time either using a dye-based qPCR or probe-based qPCR.
So as you mentioned above, qPCR and Real Time-PCR are the same.
As you asked, qPCR can be RT-qPCR only and only if the starting genetic material is RNA and and the quantification of the cDNA is done by real time PCR.
I hope I have been able to explain in a simple manner.
Best wishes.
  • asked a question related to Real-Time PCR
Question
3 answers
Hello everyone.
I am about to search for the expression of genes including p53 in methylated and non methylated HPV samples. Should I extract DNA from the methylated samples and use SYBR green and Real-Time PCR to detect any possible differences? I have already the DNA from the non-methylated samples and cannot do an RNA extraction from them.
Relevant answer
Answer
You have a lot of options if you extract DNA and RNA from your methylated samples you could. Sequence the DNA to find methylation differences between the two regions and then compare this to RNA-seq data from the methylated samples to draw some direct correlations between methylation and gene expression. It will also allow for a global view of methylation and gene expression changes instead of only a few genes.
  • asked a question related to Real-Time PCR
Question
14 answers
To perform HRM analysis for genotyping on CFX96 machine for the first time, BioRad recommends to use HRM calibration kit along with Precision melt analysis software. I am just wondering whether simply using any good quality DNA binding dye along with standard PCR reagents will work or not?
Relevant answer
Answer
Hi all,
I followed the Lukas Beule logic here:
And made a shiny app with quite a simple GUI for HRM analysis. The app needs no installation and can be accessed via the link:
The GitHub project page is here (the quick guide is in README):
Please feel free to contribute, post any issues and suggestions!
Main app features:
1. Data manipulations (increase the resolution, normalize, trim the temps)
2. HRM analysis (melting curves, difference curves, denaturation curves)
3. Clustering (4 algorithms, 2 modes (on melting temps (Default mode), or on a whole data range (HRM mode)))
4. Find the optimal number of clusters for k-means and hierarchical algorithms
  • asked a question related to Real-Time PCR
Question
5 answers
I am exploring a number of SNPs, unfortunately although the test are ok, I am perplexed because my preliminary results are nearly all against what is reported in the literature.
To confirm my workings, I need to understand if I have done this correctly.
I am using prepared primers from TaqMan for a realtime PCR. This uses two dyes: VIC and FAM, each associated to one allele.
An example of a primer would be the following:
CCAGCGGATGGTGGATTTCGCTGGC[A/G]TGAAGGACAAGGTGTGCATGCCTGA
where the manaul stated that A should be VIC and G would be FAM.
Does this mean that those results with a low Ct on VIC and a high Ct on FAM would be A or G allele?
Relevant answer
Answer
As long as you're certain VIC is for the A allele, and FAM is the G allele then a low CT on VIC will be an A.
  • asked a question related to Real-Time PCR
Question
6 answers
Hello everyone, we are acquiring a new molecular biology laboratory with the fundamental objective of identifying species of microalgae and cyanobacteria. Perhaps you could help us decide if it is worth buying a real-time pcr, since an endpoint pcr is sufficient for our objectives.
Relevant answer
Answer
If your immediate needs are endpoint pcr then I would look into whether you can get discount for buying 2 machines and get a gradient pcr machine as well as a simple end point pcr machine . They can both be used for simple pcr and the gradient machine will save a lot of time setting up new primer sets as your work diversifies. The maintenance on end point pcr machines will also be cheaper than the rtpcr machine.
  • asked a question related to Real-Time PCR
Question
1 answer
Good morning,
Recently I am using QuantStudio 3 RealTime PCR 0.1 ml 96 well FAST. I am running experiments of amplification and melting curve analysis by SYBER GREEN I chemistry to identify different genotypes for gene of interest in DNA samples. Is possible to run high resolution analysis, and so to visualize different graphs from the basic melt curve and Tm, in order to better discriminate the genotype of my samples in an easier way? I am using the software suggested by Thermofisher (QuantStudio Design & Analysis Software v1.5.1), do you know if it would be better downloading a different or a specific software instead?
I would be glad to have any suggestion from you
Thank you
Relevant answer
Answer
A platform-independent S/W would need you to export the instrument files directly. The qpcR library is an R-based package that assists researchers in the modelling and analysis of quantitative real-time PCR data. It is able to perform a melting curve analysis which is derived from the chipPCR and the MBmca packages.
  • asked a question related to Real-Time PCR
Question
4 answers
I performed real-time PCR on luteal cells from cows which were treated with various factors for a period of 6 hours. While for western blot, cells were stimulated with the same factors but for a period of 24 hours. Is it possible that a given factor inhibits the expression of the studied gene and increases their protein level? Is the opposite situation also possible, when there is an increase in gene expression, while in western blots a decreased level of protein is observed? Is the difference in times of influence of the given factor could be the main reason or or other mechanisms may cause such results?
Relevant answer
Answer
Hey Robert,
happy new year to you.
in many cases mRNA levels correlate with protein levels, but this might not always be the case. RNA biology research gets a big momentum and mRNA can be stored or faster degraded in demand of the encoded protein. So mRNA present or absent in the cells does not necessarily mean that the protein level correlates to it.
We made these experience to times in macrophages. One time, mRNA levels for Cd11b, ASMase and Nox2 were equal between two macropage groups, we investigated. But protein levels showed a completely different pattern. Western Blot showed that peritoneal macrophages had much more CD11b, ASMase and Nox2 than bone marrow derived macrophages. So here, while the mRNA tells you all is equal, the functional protein levels in the cell are not.
For the example please have a look at:
The other example was observed in microglia. Here the mRNA of angiogenic growth factors VEGF, Ang1 and Ang2 was increased after stimulation, but only VEGF was produced and secreted as actual protein.
For that have a look at:
So in my opinion, only mRNA levels will not tell you the whole story. You do not have to perfom FACS analysis. A simple Western Blot on TLR4 will do the same.
All the best and stay healthy,
Marc
  • asked a question related to Real-Time PCR
Question
3 answers
High-Resolution Melting (HRM) analysis is a relatively new, post-PCR analysis method used to identify variations in nucleic acid sequences. The method is based on detecting small differences in PCR melting (dissociation) curves. It is enabled by improved dsDNA-binding dyes used in conjunction with real-time PCR instrumentation that has precise temperature ramp control and advanced data capture capabilities. Data are analyzed and manipulated using software designed specifically for HRM analysis.
Relevant answer
Answer
you can use it for SNP detection
  • asked a question related to Real-Time PCR
Question
6 answers
Dear all,
I wanted to run HRM ( High Resolution Melting) using Corbett Rotor-Gene 6000 Real Time PCR Machine. When I opened the HRM folder of software , there was two option for running including HRM and HRM with pre-amplification.
What is the difference between them?
Many thanks
F.Esmaeili
Relevant answer
Answer
follow
  • asked a question related to Real-Time PCR
Question
3 answers
Currently I process a commercial Multiplex Realtime PCR kit on Quantstudio 5 system, but almost 20% of the runs has a distorted amplification plot (see pictures attached below).
Does anyone suffer this situation? What can I do to improve it?
Relevant answer
Answer
Thanh Tran Ok. first id you use the Taqman you need to run only one step. For example 95°C for 5 min; 40 cycles of 95°C for 15 sec, 60°C for 4 min (in this step you make the data collection).
When you try to optimise the reaction, you need to run the same concentration of DNA and try to run in simpleplex and multiplex.
  • asked a question related to Real-Time PCR
Question
3 answers
Hi all,
I am trying to set up my standard curve for qPCR analysis, presence absence of D. septosporum, using a QuantStudio 5 real-time PCR system and associated software.
I am using a 5X dilution series with a multiplex mix of fungal specific primers with ROX probe and 18S control primers with TAMRA probe.
Unfortunately I have not been able to generate a suitable curve for the fungal specific. So far, I have ran a temperature gradient to optimise annealing temperature.
I have an acceptable curve for the 18S which says to me my dilutions are fine.
I have adapted the volume of sample in each well and have found the amount that works well for the 18S primer-probes.
and I have eliminated the passive reference dye as an issue.
My amplification plots look good and how you would expect them to, however the curves are all over the place.
At this point I am struggling to find where to go next, any advice or suggestions would be greatly appreciated
Thank you
Relevant answer
Answer
Hi,
I guess a multiplex qPCR is difficult to set up as all involved amplicons can have different rates of amplification and there can be competition between them.
You can pick the content of some wells in the plate and run them on a 2.5 - 3 % agarose gel to see what the amplicons look like.
How many targets are there in the multiplex? Have all the probes labeled with the same dye sounds strange to me, I'd rather expect to do it with 1 dye per target and just run them in 1 single reaction rather than separate reactions to save limited material. But this is a naive remark, I've never performed a multiplex qPCR.
Regarding this issue:
"My amplification plots look good and how you would expect them to, however the curves are all over the place."
I'd say that at a given amount of starting cDNA template material you can get a nice amplification curve that is the sum of all participating amplicons, but this repartition of contribution to give the final detected ROX signal does not evolve linearly with serial dilution of the concentration of the starting template for each of them and gives a strange standard curve. If that is the case, the assay is rather qualitative and binary and test samples considered positive or negative above and below a certain threshold but without quantification.
Regarding the standards dilution range, as Sayante Bera says, I also prefer 10x serial dilutions (i do 10e0 to 10e-5) as it covers a larger CT range (log 2(10e5) = 16,6 CT). I've seen people do 1/2, 1/5, 1/125 and 1/625 standards (log2(625 = 9,3 CT). However this is not a problem if the tested samples all end up nicely somewhere within the standards.
Finally, a possible alternative to multiplexing is the fluidigm technology that probably requires less cDNA for x reactions than the usual plates and finally costs less than setting up a multiplex
Hope this helps
Best,
Daniel
  • asked a question related to Real-Time PCR
Question
3 answers
I am working on quantstudio 5 system with diagnostic test kit - AZF Microdeletions REALTIME PCR genotyping kit (master mix is aliquoted to every separated pcr tube, I only added taq polymerase, mineral oil and DNA for pcr preparation step)
After doing several tests, i found some abnormal amplification curves (heaved curve with a small rise at very end pcr cycles) (attachment picture).
Does anyone know what 's happened?
Besides, the threshold on the picture is set automatically by QS5 system, can I trust this threshold to determine whether my pcr target presents or not?
I am really appreciated for your help.
Relevant answer
Answer
Thanh Tran It seems like there is no amplification and the primers are not working. You can compare this plot with your "no template control" sample, if that is similar to this plot shown here then it validates primers are not good for quantification or the qPCR condition is not optimized. You can also do a melting curve analysis which may show an increase in fluorescence might be due to primer-dimer.
  • asked a question related to Real-Time PCR
Question
2 answers
Hengzhi Shi , Minwei Li , Xiaocui Huang, Chaoqun Yao , Xueqiu Chen , Aifang Du , Yi Yang
  • PMID: 32731054
  • DOI: 10.1016/j.vetpar.2020.109193.
Relevant answer
Answer
There you go.
good luck
  • asked a question related to Real-Time PCR
Question
3 answers
Dear everyone,
I'm working on a project to detect the deletion of exons. We are working with Realtime PCR and using Livak's method. But we don't have a positive control of the target gene, we only have a positive control of a different gene. They are on the same chromosome. Can I use gen A's exon for a positive control to detect a deletion of gen B's exon via Real-time PCR?
We think yes because they follow the same principles. But I don't see any other published paper that did the same way we do. If anyone who has done this before or knows that it's ok or not, please let me know.
Thank you in advance and hope you all have a nice day.
Relevant answer
Answer
  • asked a question related to Real-Time PCR
Question
1 answer
When we want to use Lanthanide-based DNA dyes (Eu, Tb)for time-resolved real-time PCR, the colors are limit. So how to develop more multi-color Lanthanide-based DNA dyes?
Relevant answer
Answer
In fluorescence-based detection, various types of imaging probes have been commercialized. Most imaging probes are fluorescent organic dyes that are used for sensing target ions or molecules. However, organic dyes have several drawbacks, such as poor chemical stability, photo-bleaching, broad emission spectra, and difficulties in conjugation with targeting ligands. Thus, inorganic nanoparticles (NPs) have been developed to replace conventional fluorescent organic dyes. Among them, semiconductor quantum dots (QDs) are promising candidates for fluorescence-based detection . Compared with organic probes, QDs have advantages, such as good chemical and photo-stability, a tunable emission wavelength by controlling the particle size, easy conjugation with biomolecules, and narrow emission spectra for less spectral overlap. Over the last two decades, QDs have been applied in the fields of animal imaging and disease marker sensing . Even though QDs exhibit interesting properties, their usage has been limited by critical issues such as potential human toxicity. Common QDs are composed of heavy metals (e.g., cadmium, lead, and mercury), which are potentially fatal to humans. In addition, there was a need to develop imaging probes with better detection sensitivity than QDs. To overcome these obstacles, new kinds of lanthanide-doped NPs have attracted attention as the next generation of imaging probes for highly sensitive fluorescence detection.
  • asked a question related to Real-Time PCR
Question
12 answers
I do a lot of RT-PCR and always include a no-RT control (without reverse transcriptase) for each of my samples, so that I can rule out DNA contamination in my RNA samples. Unfortunately, the SuperScript III 1-step RT-PCR kit (with enzyme mix of SuperScript III reverse transcriptase and Platinum taq polymerase) does not come with enough buffer to allow for this, which is a shame as this kit is very expensive. I contacted Thermo and they told me that they cannot sell me spare tubes of buffer and also cannot give me the composition of their secret optimised reaction buffer. This is a shame, though I totally understand why they would want to maximise their profit margins by pretending that their kits contain enough buffer for 50 reactions when in reality, they don't.
This led me to wonder if it isn't possible to guess the buffer composition and try to make it myself. The one hint that is given on the product data sheet is that the 2X reaction buffer contains 0.4 mM of each dNTP and 2.4 mM MgSO4. I also know from the information given with the Platinum taq polymerase what the composition of that reaction buffer is. I therefore wonder if one couldn't make the 2X reaction buffer for the kit by simply making a buffer containing 120 mM Tris-SO4 (pH 8.9); 36 mM (NH4)2SO4; 2.4 mM MgSO4; and 0.4 mM of each dNTP (clearly the platinum taq polymerase is very sensitive to chloride ions and the SuperScript III reverse transcriptase requires magnesium ions). I just have this very strong feeling that if one were to make that buffer, it would work very well indeed with the SuperScript III one-step RT-PCR kit as a replacement for the 2X reaction buffer, and could be very useful for making sure that the one gets the most out of this very expensive kit. I'm not sure how Thermo would feel if someone were to try that and publicise it on the internet, but somehow I feel like that recipe would indeed work very well....
Relevant answer
Answer
120 mM Tris-SO4 (pH 8.9); 36 mM (NH4)2SO4; 2.4 mM MgSO4; and 0.4 mM of each dNTP - use as a 2X reaction buffer.
  • asked a question related to Real-Time PCR
Question
8 answers
Dear members,
you all have helped me along very much so far. I have now encountered yet another challenge: I need to design primers for 15 proteins which cover more than one splice-variant of the gene in question (ideally all splice variants).
As i know so far, Ncbi_Nucleotide lists all known variants and i can pick a primer via the button "pick pimers" for each specific primer. However, findig a primer wich picks up a lot of different splice variants may be just a question of luck and a lot of trial and error in my eyes.
Is there any programm/website or loophole which could help me along?
Again, I will deeply appreciate your answers.
Greetings from Munich
Michelle
Ps: Because of this community I could actually get my project going last week. To all members: THANK YOU SOOO MUCH!
Relevant answer
Answer
Yes! This new feature "primers common for a group of sequences" is more than welcome!
  • asked a question related to Real-Time PCR
Question
18 answers
Hi everyone,
I am equipping a new molecular biology/microbiology laboratory and I need to purchase a PCR and/or a real-time PCR machine. So I'm looking for suggestions.
Is there a new model that performs well and allows highly reproducible results every time?
Thanks ahead for your input!
Carla
Relevant answer
Answer
The Bio-Rad CFX384 high-throughput system is really good.
  • asked a question related to Real-Time PCR
Question
5 answers
When performing Viral RNA extractions I perform a negative extraction using water. This is then run as a negative control for my RT-PCR reaction. Recently this control has been showing up RNAse P positive. In addition, when I run the same extract negative sample in duplicate on my PCR plate, sometimes I get RNase P in only one of the duplicates. What is happening? It only ever happens in the Extraction Negative, it never occurs in my PCR negative control.
This issue is occurring for multiple technicians.
Relevant answer
Answer
I m taking same problem. It is not about contamination. Probably dimer problem.
  • asked a question related to Real-Time PCR
Question
7 answers
Hi dear fellows,
I would like to perform ChIP-PCR on the promoter sequences of genes, but I am not quite sure how to design primers for the promoter sequences. Can someone please help me?
My second question is: is it possible that the real-time PCR for these primers has to be performed in some particular way?
Thank you very much for help
Relevant answer
Answer
You can use genomatix promoter analysis online tools or CLC genomic workbench software
  • asked a question related to Real-Time PCR
Question
2 answers
Anybody has a good recipe for homemade SYBR green mix for real time PCR?
To my understanding, one of the key factors is the taq enzyme because most enzymes are inhibited by the SYBR dye.
Relevant answer
Answer
Is the recipe by Mark working? Please share the experience. Note section is little confusing. Can you please elaborate it @Mark
  • asked a question related to Real-Time PCR
Question
5 answers
We know that passive reference dye/ROX can help reduce variations of fluorescent values in samples.
When utilizing the Rotor Gene-Q for the real-time PCR experiment, usually, the SYBR Green master (No ROX) dye is used. Why don't we use ROX dye while using Rotor Gene-Q?
What is the main feature that makes this machine unique in comparison with other real-time PCR instruments, e.g., ABI thermocyclers in the use of Passive dye?
Relevant answer
Answer
ROX is a passive reference dye which is not required in machines like Rotor-Gene Q from Qiagen because of the centrifugal rotary design. Each PCR tube aligns with the detection optics during centrifugation in such a manner that the fluorescent signal collected don't have sample to sample variation and also the optical pathway is short between the optics and the sample. This eliminates sample-to-sample variations and edge effects seen in PCR instruments with plate setup like the ABI Real-Time PCR.
  • asked a question related to Real-Time PCR
Question
2 answers
I need to co-culture MLNs cells from a mouse in 24 well plates with bacteria. I will seed the cells 5x10^5 cells/well with the presence of bacteria 5 to 10 times higher. Is it possible for me to get a good quantity and quality RNA from 5x10^5 MLNs cells?
Thank you very much!
Regards,
Relevant answer
Answer
Walid Hassene Hamri Thank you very much! I will do 24hr incubation, I hope the cell still alive.
  • asked a question related to Real-Time PCR
Question
1 answer
Dear all, Recently we tried to compare mRNA expression levels of a gene via real-time PCR in 40 colorectal cancer clinical isolates and 10 normal mucosa samples.
Interestingly, a reasonable expression was determined in tumor samples (Cq: 25-31) while no amplification at all (No Cq) was observed for normal mucosa samples. All the samples were processed for RNA extraction, cDNA synthesis and confirmation for a reference gene at same time. Our equipment is also working fine considering its 96 wells.
Would like to hear expert opinion from this forum for possible reasons why a reasonable expression profile was there for all tumor samples, while no signal at all was observed for the normal mucosa samples in the performed real-time PCR experiment.
Relevant answer
Answer
Dear Asim,
Your results are suggesting that the gene you are assessing is maybe not expressed in non-cancerous cells. Which is the gene you are evaluating? Maybe we can check in silico if it has been reported expressed or not.
KR.
  • asked a question related to Real-Time PCR
Question
3 answers
I would like to compare expression of my gene of interest (GOI) between non-treated leaves, stems and roots of my plant. In that case I don't have any control sample here.
I evaluated efficiencies of GOI and reference gene primers in all of types of my material (leaves, stems, roots). The efficiencies of GOI vs reference gene primers are different in the tree groups of material and low (for leaves 64% vs 72%, for stems 66% vs 60%, for roots 70% vs 80%). I tried to redesign primers, but I obtained more or less the same results. My primers did not produce any dimers. What is worth mention, I isolated RNA with kit for plants rich in metabolites. Maybe the problem is the nature of my plant material, it contain some plant inhibitors.
Because of differences between primers efficiency I can't use delta delta ct method. I could use Pfaffl formula, but as I said I don't have control sample (calibrator). I could pick one of the material type and make it a control, but I have differences in primers efficiencies, and I think it would not be proper. I know the efficiencies are low, but it seems I have no choice here. Did you ever see such low efficiencies? What would you suggest to analyse my qPCR data? What could be a calibrator for my experiment?
Relevant answer
Answer
Hi Colleague
Find the following URL may help you:
Regards...
  • asked a question related to Real-Time PCR
Question
8 answers
Recently, I have been investigating of expression of Sall-4 in two different types cancers. Due to of acceptable melting peak of Beta Actin(and Cq=17), I am sure the quality of cDNA is pretty good.
#PCR #QPCR
Relevant answer
Answer
To compare transcript levels of genes expressed at a very low level, one can also enrich the targets by including a pre-amplification step.
I have included one reference here. There are many others as well:
  • asked a question related to Real-Time PCR
Question
4 answers
I would like to know how to generate a dendrogram from repetitive element PCR profile. Please see the attached publication.
If somebody knows how to do that, please teach me.
Relevant answer
Answer
Hi
this is a question. In profiling the seed storage proteins of Soybean, I saw extra bands expressed by some other samples. Please should I focus on absence and presence of bands shown by all samples, with respect to the bands shown by the protein standard(marker) in drawing my dendrogram? or should I include the extra bands that did not correspond to the bands on the protein standards?
  • asked a question related to Real-Time PCR
Question
4 answers
For comparing the quality of two products, I used the same sample and primers to do qPCR, the results are as follows. As the figure shows, Tm values are a little different. I wonder if this can tell which of the two products is better, or whether it is judged by other parameters? Thank you.
Relevant answer
Answer
Thanks for all your great comments and suggestions. These two products are all 2x premix qPCR reagents, and the buffer probably are different. I will check out.
  • asked a question related to Real-Time PCR
Question
5 answers
Hello.
I would be thankful if anyone could answer my question.
We are Analyzing the expression of a certain gene in our research.
We have extracted all the mRNAs in the cell and now I was wondering if we should Perform a PCR before doing real-time PCR? ( And Not for the purpose of quality check and control, But for the purpose of extra-Amplification)
wouldn't doing PCR on Our cDNA targets before real-time PCR result in a false increased Data about our gene amount?
Relevant answer
Answer
You are correct. You should always perform PCR before new rt-PCR, but its for the purpose of quality check, control, checking for possible contamination, and if you want the product sequenced, not for extra-amplification. If the problem is the quantity of the gene and late amplification, you can increase the cDNA concentration during rt-PCR.
  • asked a question related to Real-Time PCR
Question
3 answers
Dears,
I need help with the interpretation of why not obtain results in real-time PCR when I use Taq man SNP genotyping assay ID: rs 22756913 (IL17A) from Thermo fisher scientific
where the final volume reaction was10 microliter
Taq man SNP genotyping assay (20X) working was 0.3 microliter
DNA sample volume was 3 microliter with a concentration of 0.6 ng
the master mix was 5 microliter
nuclease-free water added to complete the total volume of 10 microliter
but when I use another SNP ID: rs 40401 from the same company (Thermo fisher ) with the same concentration and the volumes, I obtained results in real-time PCR
Regards.
Relevant answer
Answer
Hi Noor Nihad Baqer , probable explanations are one or more of the following:
1. Your samples only contain just C or T alleles (emsembl reports A/G). Your probes are designed to detect just A or G. Different dog breed maybe?
2. DNA is degraded or contaminated with a PCR inhibitor.
3. Not enough sample, if you are using an standard master mix is better to use from 10-100 ng. Fast master mix 1-10 ng. In practice 33 ng always works well for both master mixes.
4. TaqMan assay must be 0.5- 1 uL for your 10 uL of reaction volume (at least for that particular assay)
5. Degraded probes due to light exposure or more than 3 thaw cycles.
6. Suboptimal probe design, CCC or more in a row, etc.
7. Primer dimerization due to high affinity or previous F & R mixture.
8. Change in the PCR cycle.
I hope this may be useful.
  • asked a question related to Real-Time PCR
Question
2 answers
Hi,
Does anyone know how to make a Region Of Interest (ROI) plate?
Or even what is in it?
Regards,
Mark.
Relevant answer
Answer
its FAM dye.
  • asked a question related to Real-Time PCR
Question
10 answers
Why are CT values in the Realtime PCR hidden after the 35th cycle ?
Why are CT values in the Real-time PCR hidden after the 35th cycle ?
Where I noticed that the CT value had been positive and then, when the last five cycles approached, it disappeared so that it showed the value is unknown
I am using Applied Biosystems 7500 Real-Time PCR System for MTB kit , and there are two target the first one JOE is Intrnal Control (IC) and The second FAM which is the positive value C+ .
But I noticed the disappearance of the FAM value, which was CT 19 and 22 for some samples, and then it became indeterminate (unknown)
While the values of the JOE have never changed as shown in pictures
Please,if anyone know the reason for this situation
with thanks and respect
Mohammad Alzeyadi
Relevant answer
Answer
I my opinion, this depends on/is wassociated with your intrumental and/or software settings and have nothing to do with a potential "ivalidity of values after the 35th cycle". I would propose to check the settings for measurements and read out depiction/presentation (software settings).
  • asked a question related to Real-Time PCR
Question
5 answers
Hi
I will be happy for your help.
I'm doing real-time PCR with two primers called MT-TL1 and 18S, for mtDNA and houskeeping gene, and I got positive control on both NCT. I tried also different primers: ND1 and B-Globoin but also in them I'm getting positive ct value on ND1 gene (mitochondrial DNA gene), the b-globolin gene was good (undetectable).
I checked my reagents and they are good, there is no contamination. On these 2 last primers shouldn't be a primer-dimer problem.
I'm getting values of: 36.95, 35.59, 35.49
I used 10uM primer conc.
Thanks.
Relevant answer
Answer
Signals over CT values 40 and some say 35 should be handled carefully. In my experience, some low expressed genes can be detected around 35-38 but even NTC in most cases will produce a signal above the threshold after 40. So, as suggested above the best way is to run your PCR product on a gel. You can also reduce primer concentrations to half. In some cases, it helps to reduce the background noise signals. remember primers are DNA that can attach and amplify themselves and hence produce a signal when using general binding dyes such as SYBR-green and other similar dyes.
  • asked a question related to Real-Time PCR
Question
4 answers
I would like to get rid of heparin in RNA extracted from heparinized plasma. Now I'm using heparinase II (Sigma H6512-10UN) dissolved in 100 uL of 100 mM sodium acetate pH 7.0.  I used 1, 2 or 3 uL of heparinase with approximately 1 ug of RNA and incubated at 37 C for 1 or 2 hours continuing with 1 step RT-PCR but didn't success.  Is there other protocol to get rid of heparin in RNA extracted from heparinized plasma by using heparinase?
Relevant answer
Answer
Hi Sirinart,
I would like you to share the protocol you eventually used to resolved this challenge. Thanks
  • asked a question related to Real-Time PCR
Question
9 answers
Hello,
I am working on a project involving detecting closely related fish species from environmental samples. I have 3 closely related species whose sequence similarities are such that it will be very difficult to design 3 separate qPCR assays that will distinguish them from one another without cross amplification, or at least cause reduction in reaction efficiency in mixed species samples due primer competition.
I was thinking of an alternative approach involving qPCR multiplexing, but do not have enough experience with qPCR chemistries to know if it will work.
What I am thinking is this: designing a multiplex qPCR assay with 1 conserved primer set that will amplify all 3 species, along with 3 separate probes that are species specific.
Is this something that would be possible? It seems like in general, multiplex reactions are composed of 3 different primer/probe sets that target non-overlapping regions?
Any thoughts would be helpful
Thanks
Relevant answer
Answer
Could you post the reference? It sounds impossible to me, but they may have found a trick that I haven't thought of.
  • asked a question related to Real-Time PCR
Question
3 answers
Hi everyone,
I want to add some barcode sequences to primers then PCR them from different samples. Just want to know if there are any principles behind the barcode? I mean the length or the sequence features.
I know there are some commercial barcodes. But I need to add barcode to primers not the PCR product.
Hope for your reply! 
Relevant answer
Answer
I am studying a similar technique and had same question.
A paper i read talks about adding about 5 different 10nt long barcode in 5' end of the primer. This is called compressed barcoding space. According to this concept, one can create few number of barcodes and use its permutations to barcode many primers. I was wondering if it will cause any issues during PCR.
Can you please tell me from your experience how feasible is such experiment.
Incase, you are wondering what i'm reading https://www.biorxiv.org/content/10.1101/2020.04.06.025635v1
it is wide scale pooled sequencing for covid testing.
  • asked a question related to Real-Time PCR
Question
4 answers
Zhao & Fernald (2005) have developed a tool that calculates qPCR efficiency from the kinetics of each individual reaction directly, without the need of a std curve.
Relevant answer
Answer
Hi, should we have triplicates for standard in qPCR? Or not necessary?
  • asked a question related to Real-Time PCR
Question
1 answer
A baby with congenital cmv infection tested positive using realtime pcr with 1000+ copies/ml of DNA. Further doctors ask for po65 assay why?? How do they go for treatment??
Relevant answer
Answer
The pp65 assay is an indirect fluorescent antibody test. The virus that is human CMV (HCMV) has phosphoprotein 65 (pp65) which is targeted by the antibody assay. Since the virus localizes in monocytes, positive pp65 antigenemia indicates the virus is present and active infection is present. The PCR was able to detect the viral copies which would help the clinician know the viral load of CMV. Monitoring treatment with viral load assessment may help in therapeutic decisions.
  • asked a question related to Real-Time PCR
Question
5 answers
Hello everybody.....
the concentration of my plasmid DNA is 126ng. i want to do real-time PCR taqman probe detection......i want to do serial dilution that should start from 10e8 copy number....so can anybody tell me how to dilute it (how much plasmid DNA and ddwater should be added to make it 10e8). i have attached the calculated values in the attachments. thank you
Relevant answer
Answer
Katie A Burnette Hi Katie! I need your help with a similar question!
  • asked a question related to Real-Time PCR
Question
4 answers
There are various methods of determining amplification efficiency as summarized under number 1 and 2 and in the bullets below:
1. From calibration curve slope as determined by:
· Fit-point method;
· Second derivative maximum for the 4 parametric logistical model;
2. From single amplification plots using algorithms like:
· Mid-value point regression — also known as data analysis for real-time PCR or DART-PCR;
· Window-of linearity algorithm or LinREG PCR; and
· Noise-resistant iterative nonlinear regression or RealTime PCR Miner.
So, I would like to know the most rigorous and classical method examines the slope of a calibration curve?
Relevant answer
Answer
  • asked a question related to Real-Time PCR
Question
4 answers
Hello Everyone,
I wanted to run RT-PCR using onestep real-time PCR systems and SYBR green (ThermoFischer) to check the gene expression in bacteria. I wanted to directly use 50 ng of DNA samples extracted from bacteria. The Master-mix includes DNA template, DEPC water, forward and reverse primers. The reverse transcriptase enzyme was excluded since i'm not using RNA as a template. I wanted to know whether my protocol is wright?
Looking forward to all.
Thanks and regards,
Arun
Relevant answer
Answer
Since you are using DNA as a template you should follow the conventional PCR. However, it would not help to estimate gene expression.
It is better to extract RNA and follow the gene expression study, but if you still want to use DNA as a template - you can sequence the PCR product to know about your target gene. Whether it is a constitutive gene or facultative gene and blasting the sequence might give an answer to your desire.
  • asked a question related to Real-Time PCR
Question
7 answers
I'm designing some primers for qRTPCR. Does anyone have any suggestions for a good qRTPCR primer design tool? (I expect to need to check for hairpins and dimers and what not, but would prefer not to do everything by hand....)
Thanks!
Relevant answer
Answer
Hello
I will prefer to design RT PCR primer manually rather than designing them by software because manual designing gives me the flexibility to choose my parameters which are best for my primer. For manual designing,  first, you have to download mRNA sequence of your gene from NCBI. Copy paste this sequence into a new word file. Now you have to select 20-21 nucleotide from that sequence having AT in the starting and CC or GC in the last (i prefer this). Paste this sequence in oligo analyser (https://www.idtdna.com/calc/analyzer) in google tab select qPCR in parameter set and press analyze. It will give you properties of your primer. If your primer has properties which Sujitha mentioned (i prefer tm-60-61 degree, GC-55-60 and CC or CG sequence in the 3 prime end of my primer) you can choose it as your forward primer. similarly, for reverse primer you have to find the best primer after 100-110 bp your forward primer sequence in mRNA sequence. Do same procedure as you did for forward primer. select sequence (20-21bp, paste in oligo dt, analyse properties if its good then its complement sequence would be your reverse primer. I generally prefer 100-110bp amplicon length for RT PCR primer. Some important things you have to keep in mind is annealing temperature difference between forward and the reverse primer should not be more than 1-2 degrees. If you have doubts you can ask again. Thanks and best wishes.
  • asked a question related to Real-Time PCR
Question
6 answers
Is it necessary to perform RT-PCR analysis of genes that show an increase or decrease? Or is it just for control purposes in RNA-Seq Analysis?
Relevant answer
Answer
While qPCR is most commonly used, digital PCR (dPCR), as a newer technology, can work as well. dPCR may even perform better for low abundance transcripts or subtle gene expression changes.
  • asked a question related to Real-Time PCR
Question
4 answers
Hi there,
I want to use ddCt to analyze my qPCR results, however I am not exactly sure on how to proceed and when to average the replicates. Also, can we use ddCt when having more than 1 factor (e.g. treatment dose and treatment time)?
For example, I performed a cell culture experiment. I did 3 replicates (one each month during three month). I had two treatment times and three treatment doses (+ untreated control).
For each replicate experiments, cells were treated for two hours, or for 24hours, with a concentration of 0M (control), 10-7M, 10-6M or 10-5M. Cells were harvested, and using qRT-PCR I analyzed the expression of target genes + 3 reference genes.
In this experiment I want to see 2 things :
1. If gene expression is different in treated cells vs untreated control.
2. If gene expression is different according to duration of treatment (2h vs 24h).
I am not sure about how to correctly use ddCt and how to compare my two factors.... Should I first take the 2h experiment and calculated ddCt for treated vs untreated and than do the same for the 24h ? Then how should I compare times (2h vs 24h) using the ddCT ? Also, should I right away average my Ct values of the 3 replicates ?
I've attached my excel file with my ddCT calculations.
I really want to understand the rationale behind it..!
Thanks for your help
Relevant answer
Answer
Adrian Abdo Ok great, thank you very much, I understand !!!
  • asked a question related to Real-Time PCR
Question
8 answers
Hello,
I already performed my quantitative PCR (q RT-PCR).
I have a lot of samples in my experiment and so they didn't fit all in the same rotor/plate (RotorGene - Qiagen). Therefore, I used a standard DNA sample on all rotors to normalize.
How do I calculate the normalization between rotors for the same gene?
I'm thinking to use the average of the DNA Cts, them correct in each rotor using the respective Ct value.
E.g: For gene ABC if I have 5 rotors/plates. The DNA Cts of each are 19, 20, 20.5, 21, 19. The average is 19.9. Then I go to the first rotor samples and add 0.9 to the Ct of each sample (19.9 - 19).
I don't know if I was clear in what I mean..
Any help is helpful :)
Relevant answer
Answer
See here for more detail:
Depending on the algorithm that you (your software) is using the values can be different but the differences between samples in the same experiment should be more or less constant.
  • asked a question related to Real-Time PCR
Question
4 answers
I am performing a qPCR standardization of some MGB probes. I have tried just a few times but I don't want to waste reagents, every time I tried the assay, there is a jagging line.
I am thinking that could be that the Reaction mix is not enough for the amplification or maybe I am doing wrongly the setup of the machine.
Do the MGB probes need an especial or different reaction mix?
These are my conditions:
Real-time PCR System: One step Plus - Applied Biosystems
Probes:
Probe1: [FAM] GGG TTT AAA GGG [MGB] 
Probe2: [CY5] GTC AAA TCA TCA TGC C [MGB] 
Primers:
1F: GTCAGCTCGTGTCGTGA 1R: CCATTGTAGCACGTGTGT 2F: AGCAGCCGCGGTAAT 2R: CTAAGCATTTCACCGCTA
Reaction mix:
Taqman universal master mix (applied biosystems): 12.5 ul
Primers 10uM: 0.5 ul
Probe 10 uM: 0.31 ul
NFW: 6.69ul
Sample DNA (5ng/ul): 5 ul
PCR conditions (As reference article indicated):
Holding stage:
50°C (2 min)
95°C (15 min)
Cycling stage:
95°C (30s)
60°C (1 min)
Relevant answer
Answer
Is it because the probe and primer concentration too low? If you signal is too low, the detection fluctuation will be amplified in the figure.
  • asked a question related to Real-Time PCR
Question
4 answers
I tried to scale down the component in reaction (from 20 µL to 10 µL using Bio-Rad Universal SYBR Green) for saving material. I wonder if I can get precise results or not with a down-scaled reaction because the RealTime PCR machine in my lab was calibrated for using 20 µL of PCR reaction.
Thanks a lot for any advice/suggestions.
P/S. For testing, I prepared 45 µL of master-mix, then separated it into 3 tubes to make 20 µL, 13 µL, and 10 µL of reaction. The result shows a little bit different in Ct and quite big different in RFU.
Relevant answer
Answer
Yes, as members also said, you can go for a 10ul reaction, we have done many times, even initially we tried the same sample with both volumes, got the same result no difference. Primer concentration, Tm, cDNA concentration should be good from your end. The rest all will go fine.
  • asked a question related to Real-Time PCR
Question
6 answers
I still get Non-specific products & multi-peak Melt Curves despite changing the annealing temperature of my designed primers several times (58C, 59C, 60C, 61C, 62C, 63.7C & 65C).
I've also changed other parameters like the concentrations of DNA & primers, however, i still get these Non-specific products & multi-peak Melt Curves. Are there other factors that i can change to get rid of them?
Thanks in advance.
Relevant answer
  • Have you tried optimising your products by standard PCR (at different Tas) and running products on a 2% agarose gel in order to confirm specificity for subsequent qPCR
  • In all honesty, if you are having recurring problems with multiple products at multiple annealing temp the best thing you can do is re design your primers
  • asked a question related to Real-Time PCR
Question
3 answers
I tried to run a qPCR assay using BioRad MyIQ qPCR machine but this machine failed to start run when I press "Run" button on the IQ5 software and showed the message which I copied below.
“Required background factor data not found. Perform background well factor collection for current seal (film), vessel (plates), base unit (yyyyyyyyyyyyy) and camera(569ER1245)”. Herewith, I attached the screen shot of the message.
This machine was purchased 5 years back. I used SYBR 1 for my experiment.
Much appreciated if anyone suggests me what I should do to sort this problem out.
Relevant answer
Answer
Hi! Did you get past this??
I am getting the same error!!
Thanks
  • asked a question related to Real-Time PCR
Question
6 answers
We are intending to purchase a Real-Time PCR.
Which instrument performs better? Whether to purchase Peltier based model or rotor based model?
Relevant answer
Answer
Yugendran T sir, as per my knowledge.
I will suggest that you decide this depending upon your work preferences and budget.
As suggested by Michael Hornsey, Peltier element-based thermocyclers are generally more versatile. Thus if you have the work based on these types of qPCR you can definitely buy this.
I wish you good luck with your purchase and may you get a good qPCR machine from this discussion.
  • asked a question related to Real-Time PCR
Question
3 answers
I have extracted total RNA from Lactobacilli and treated the samples with DNase I. When checking the -RT on qPCR, there was always gDNA contamination (appeared at cycle 33 or 35, automatic threshold) although the DNase incubation time was extended (normally 20 min, I extended 40, 50, 60, 70, and 80 min) either the enzyme concentration was increased (20%). Somebody said that it is hard to remove gDNA totally but it is still okay if the signal from gDNA does not appear before 30 Ct. I wonder if it is true or not, and would like to ask everyone for opinions about this issue.
The image shows up the result of undiluted -RT RNA sample (with and without DNase treatment). The NTC shows no amplification. With this result, can I proceed with my qPCR for relative quantification, or it need further DNase treatment?
Relevant answer
Answer
Short answer: yes, you can proceed.
The fact you're bothering to check puts you ahead of many investigators, in all honesty.
The relevance of gDNA contamination is strictly-speaking a relative issue rather than a constant one: if you're measuring a rare transcript, gDNA contamination might matter, whereas if you're measuring an abundant transcript, it really doesn't.
My rule of thumb is to ensure you have at least 6 cycles of difference between your measured GOI expression and your -RT gDNA Cq values. 6 cycles corresponds to a 64-fold difference, i.e. your gDNA contamination, if present, is only contributing 1.5% of your measured values: substantially below the sort of typical well-to-well variation you'd get simply from minor pipetting errors.
So if your -RT Cqs are all 33-35, and your GOI Cqs are all lower than ~27, you're fine.
  • asked a question related to Real-Time PCR
Question
4 answers
Recently we decide to evaluate the miRNA expression levels in saliva sample as diagnostic biomarker of cancer .
We used TRIzol extraction methods but the CT of real-time PCR for U6 gene was about 31 .
How can i optimize the extraction protocol?
Relevant answer
Answer
Thank you,
Is necessary to centrifuge the sample before RNA extraction to exclude the saliva cells ?
  • asked a question related to Real-Time PCR
Question
7 answers
Our lab just obtained some 5XFAD Het mice that we plan to use. Our plan is to use WT, Hets, and Homozygous animals and was wondering if anyone had a better way to genotype them besides using real-time PCR (which is really expensive). Anyone has any primers suggestions that we can use for normal PCR?
Relevant answer
Answer
As an update, I'm not sure these will ever be 100% reliable. For us, it's been mostly reliable. That's why we genotype at weaning and after sacking, just to make sure. Originally, we were using the suggested PSEN1 primers with the internal controls about 4 years ago. I got us to switch to APP when the PSEN1 stopped working reliably. It's a struggle that's compounded by issues we were having with DNA extraction. I think the key is having a stable positive and negative control, as what a "positive" band for the 5XFAD mutation is not 100% consistent from week to week sometimes. Our main issue was that the internal control wouldn't show up in every lane, preventing us from knowing what a WT was and what reaction just didn't work. Another issue I found is that you can get a positive 5XFAD band (in a WT animal) if you simply load in too much APP/PS1 primer into the reaction which again, is why the positive and negative controls are so key. For what it's worth, this is the protocol we're using:
5xFAD primers:
oIMR3610 5’ AGGACTGACCACTCGACCAG 3’ - APP
oIMR3611 5’ CGGGGGTCTAGTTCTGCAT 3’
oIMR1644 5’ AATAGAGAACGGCAGGAGCA 3’ - PSEN1
oIMR1645 5’ GCCATGAGGGCACTAATCAT 3’
oIMR7338 5’ CTAGGCCACAGAATTGAAAGATCT 3’ - IL-2 Precursor (internal control)
oIMR7339 5’ GTAGGTGGAAATTCTAGCATCATCC 3’
APP
Prepare PCR master mix (X # of samples + 1-2) (5XFAD APP)
4.0µL Water (PCR Grade)
10µL RED Extract-N-Amp PCR Reaction Mix (Sigma R4775) (Kit – XNAT2)
1.0µL Internal Control Primer (IL2) For (oIMR7338) (75µM stock)
1.0µL Internal Control Primer (IL2) Rev (oIMR7339) (75µM stock)
1.0µL APP Primer For (oIMR3610) (30µM stock)
1.0µL APP Primer Rev (oIMR3611) (30µM stock)
Add 18µL master mix to 2µL extracted DNA solution
Use 5XFADAPP program on PCR
94°C 2 min
10 cycles of: 94°C 20s, 66°C 15s, 72°C 10s
25 cycles of: 94°C 15s, 66°C 15s, 72°C 10s
72°C 2 min
Hold at 4°C
PSEN1
Prepare PCR master mix (X # of samples + 1-2) (5XFAD PSEN1)
4.0µL Water (PCR Grade)
10µL RED Extract-N-Amp PCR Reaction Mix (Sigma R4775) (Kit – XNAT2)
1.0µL Internal Control Primer (IL2) For (oIMR7338)
1.0µL Internal Control Primer (IL2) Rev (oIMR7339)
1.0µL PSEN1 Primer For (oIMR1644)
1.0µL PSEN1 Primer Rev (oIMR1645)
Add 18µL master mix to 2µL extracted DNA solution
Use 5XFAD program on PCR
94°C 3 min
35 cycles of: 94°C 30s, 58°C 1min, 72°C 1min
72°C 2 min
Hold at 4°C
  • asked a question related to Real-Time PCR
Question
3 answers
I performed real-time PCR using an Applied biosystems machine. The double delta Ct values ( according to the machine) for the gene of interest after certain treatments were given as -5.12454; -4.93158 ; -9.11017. Does this tell me about the fold change in the expression of this gene? If Yes, then does this mean there is negative fold change or a positive fold change in the expression of my gene of interest?
Relevant answer
Answer
The formula to convert a deltadelta-Ct to a fold change is :
2^-(deltadelta-Ct)
So in your case, you would get a fold change of +34.89 from your deltadelta-Ct of -5.12. A negative deltadelta-Ct gives a positive fold change (higher expression of your gene after the treatment).
Usually the machine can give you the fold changes directly. You might want to play with the parameters. Nonetherless, even with just the Ct values, you can manually do the calculations fairly easily.
  • asked a question related to Real-Time PCR
Question
3 answers
Can we use money detector with UV lamp to detect fluoresceins such as FAM or FITC? For example product from Real-Time PCR with FAM or FITC probe?
Relevant answer
Answer
fam and fitc excitations are out of even long UV spectrum, (that is 315 - 400 nm).
  • asked a question related to Real-Time PCR
Question
4 answers
For example we have a bacterium containing two plasmids, one of which carries a target gene. Is it possible to calculate the number of copies of this particular plasmid performing real-time PCR analysis of the target gene?
Thank you!
Relevant answer
Answer
Yes, that is possible to do. You'll need a standard curve of known copies of the target gene. To adjust for the number of cells present in your DNA extraction, you'll need either a good count of the number of cells for each sample or another standard curve with a gene from the main bacteria genome. You could set up your experiment as either a measure of exact copy number or relative to the main bacteria chromosome.
  • asked a question related to Real-Time PCR
Question
3 answers
I am doing RNA immunoprecipitation, using the RNA TRAP technology, with which you can capture actively translating ribosomes with the L10 ribosomal subunit fused with GFP, using GFP antibody coated magnetic beads. Right now I'm testing it on HEK293T cells transfected with L10-GFP and I am having trouble finding good reference genes / controls for qPCR.
GADPH & b-actin seem to be differentially expressed between the IP & the unbound (the supernatant of the IP) fractions, which result in very different & unreliable results when I look at enrichment of GFP between IP & unbound. For example, b-actin sometimes shows Ct value difference of 5 between IP & unbound fraction, of the sample.. Actually b-actin seems to be 'enriched' in the IP sample (so I suspect it binds to the beads..)
What do you suggest I do? Should I compare with the input sample? n
Relevant answer
Answer
Hi, I know this topic may be a while ago. But I recently gained some knowledge from somewhere else about what should be used as RIP-qPCR controls.
Theoretically, there is "no" proper controls when assessing RIP-qPCR, since regular internal controls such as gapdh, actin, tubulin, they should normally not be bound by the RBP of interest, which in theory, should not be in your IP-ed RNAs. I got a calculation chart downloaded from Sigma to show how to calculate ChIP and RIP-qPCR fold change, which is, you have your input, anti-RBP, and anti-IgG RNAs, input here just serves as one kind of control that amplicons will be amplified using IP-ed RNAs can be amplified in your input. Then, the comparison should only be done between anti-RBP RNA and anti-IgG RNA (none of them should contain gapdh, actin or tubulin), but you know they came from the same amount of cells (you control this), then the only thing you should do is to directly test your amplicons of interest, and calculate the (fold compared to IgG) of your anti-RBP IP-ed RNAs. Since anyway in a regular qPCR, internal control genes are only used to normalize RNA amount due to different cell numbers to start with.
  • asked a question related to Real-Time PCR
Question
3 answers
I already get SNP candidates for our target traits, then I would like use Real-time PCR based genotyping platform to check F1 population.
For establishing the marker, the SNP flanking sequences are needed.
Does any one know?
Thank you very much
Relevant answer
Answer
Choose Genome Browser, then type your SNP in the search field and you'll get the 500bp sequence around it.
  • asked a question related to Real-Time PCR
Question
4 answers
I have 2 different pairs of Primers, the annealing temperature of the 'reference pair' is 54C, while the temperature of the other 'test pair' is 60C.
I'm running my experiment on the device of Applied Biosystems '7500 Real-Time PCR System'. Thanks in advance.
Relevant answer
Answer
if the RT-PCR machine have the gradient option, then you can create a range to cover all your primers. However, if that option is not available, then you will have to run the primerss ndividuallyi
  • asked a question related to Real-Time PCR
Question
3 answers
I am doing realtime PCR for a known mutation.(a) Intra assay and (b)Inter assay validation are part of my experiments. According to my knowledge, Intra assay means running same sample mutliple times in one reaction and looking for the variations of results. And inter assay means running same sample in multiple different reactions and comparing the results. Now I have some queries:
  1. The sample that I used in Intra assay validation, should I be using that same sample for inter assay validation? Or I can use another sample?
  2. what is the minimum number of reactions for each assay validation? Like how many copies of sample 'x' should i have in a reaction of my intra assay validation.
  3. What is the minimum acceptable number of reactions for each sample in Inter assay validation.?
I hope my question is clear.
Regards
Relevant answer
Answer
  • asked a question related to Real-Time PCR
Question
8 answers
Hi, everyone
I am extracting a total RNA from rat brain samples for real-time PCR studies, but unfortunately, there is DNA contamination in gel electrophoresis. I tried to remove it and I failed.
By the way, I prepare to don't use DNAse treatment. (maybe the last option)
which part may cause this problem you think?
Relevant answer
Answer
Hi,
Maybe you can try with Trizol extraction. If it does not help you can continue to purify RNA extract on DNeasy columns from Qiagen (or some equivalent kit), using DNase treatment. This is our normal procedure when preparing our RNA for NGS.